December 6, 2012 <Virtual screening>
10 best docking poses with scores screened against CBkin_UT library
December 5, 2012 <Enzyme Inhibition Assays>
Compound enzyme5154121 was used.
Absorbance at 410nm
Run1
Reading 1
Reading 2
Avg
Avg-enzyme control
STDV
A1
0
0
0
0
0
B1
0
0
0
0
0
C1
0.036
0.033
0.0345
0.0345
0.002121
D1
0.033
0.033
0.033
-0.0015
0
E1
0.026
0.027
0.0265
-0.0065
0.000707
F1
0.072
0.075
0.0735
0.047
0.002121
G1
0.052
0.047
0.0495
-0.024
0.003536
H1
0.063
0.064
0.0635
0.014
0.000707
I1
0.002
0.003
0.0025
-0.061
0.000707
Run2
Reading 1
Reading 2
Avg
Avg-enzyme control
STDV
A1
0
0
0
0
0
B1
0
0
0
0
0
C1
0
0
0
0
0
D1
0
0
0
0
0
E1
0
0
0
0
0
F1
0
0
0
0
0
G1
0
0
0
0
0
H1
0
0
0
0
0
I1
0
0
0
0
0
Result: I found the reason why the absorbance is way too low. I stored the concentration buffer #1 in the -20 without glycerol.
December 4, 2012 <Enzyme Assays>
Absorbance at 410nm
Absorbane
Run 1
Absorbance
Run2
Absorbance
Avg
Absorbance
Avg-A
STDV
A
0.054
0.056
0.055
0
0.001414
B
0.056
0.058
0.057
0.002
0.001414
C
0.128
0.125
0.1265
0.0715
0.002121
D
0.082
0.081
0.0815
0.0265
0.000707
E
0.111
0.109
0.11
0.055
0.001414
F
0.134
0.131
0.1325
0.0775
0.002121
G
0.204
0.201
0.2025
0.1475
0.002121
H
0.153
0.153
0.153
0.098
0
December 3, 2012 <Protein Characterization>
Gel image
Lane 1: marker
Lane 2: sample 0- cell lysate before induction
Lane 3: sample 1- cell lysate after induction
Lane 4: sample 2- soluble fraction
Lane 5: sample 3- flow through
Lane 6: sample 4- wash
Lane 7: sample 5- elution 1
Lane 8: sample 6- elution 2
Dried Gel image
Lane 1: marker
Lane 2: sample 0- cell lysate before induction
Lane 3: sample 1- cell lysate after induction
Lane 4: sample 2- soluble fraction
Lane 5: sample 3- flow through
Lane 6: sample 4- wash
Lane 7: sample 5- elution 1
Lane 8: sample 6- elution 2
<Measure OD of Elution #1>
The samples was concentrated and measured A280nm on Nanodrop with using storage buffer as blank.
The result:
Concentrated Elution Buffer 1
Calculation based on Googledocs.
Volume of LB Used
A
E [1/Molar 1/cm]
b
c [Molar]
uM
MW [g/mol]
g/L = mg/ml
ng/ul
Total mg in Xml
Xml - elution volume
260/280
Concentrated Elution 1
500mL
1.209
53290
1
2.27E-05
22.69
39528.5
0.90
897
4.48
5
0.95
December 1, 2012 <Protein Characterization>
After the centrifuging sample 0 and 1, only the pellets were kept and water and 6x gel loading buffer was added.
6x gel loading buffer was added to all the other samples.
The gel was placed in the mini-Protean tank and the samples were run with marker.
After 35min passed, the gel was taken out and placed into the Petri dish with nanopure water.
Gel was washed with the nanopure water for three times.
Then, the Recycled Imperial Stain was poured into the dish and placed on an orbital shaker for over an hour.
Afterwards, the gel was distained with nanopure water twice.
Tissue was folded and placed in the dish to soak up excess stain and wash the gel overnight to remove the background staning.
<Measure OD of Elution #1 and #2 samples>
The samples were measured A280nm on Nanodrop with using elution buffer as blank.
The result:
Elution Buffer 1
Elution Buffer 2
Calculation based on Googledocs.
Volume of LB Used
A
E [1/Molar 1/cm]
b
c [Molar]
uM
MW [g/mol]
g/L = mg/ml
ng/ul
Total mg in Xml
Xml - elution volume
260/280
Elution 1
500mL
0.32
53290
1
6.00E-06
6.00
39528.5
0.24
237
1.19
5
0.71
Elution 2
500mL
0.05
53290
1
9.38E-07
0.94
39528.5
0.04
37
0.19
5
-2.63
November 30, 2012 <Protein Purification>
1mL of Ni-NTA was added into the sample tube and incubated on the ice for 45min.
The, it was transferred in to the chromatography column.
It was important that in the column, the level of buffer should keep above the top of the resin to prevent affinity matrix gets dry.
[Flow through step ] After the material in the column has settled, the sample #3 was collected.
[Wash step] to remove proteins that are only loosely bound to resin. Ni-NTA resin was wash with wash buffer and sample #4 was collected.
[Elution step] the tagged protein can be released from Ni-NTA resin by using a buffer with a high concentration of imidazole. The bound protein was eluted with Elution buffer. Eluted protein was keep on ice. The buffer was collected on the ice and sample #5 was collected. More elution buffer was added and sample #6 was collected.
All the sample collected was stored in the 4degree Celsius with other samples collected before to run on SDS-PAGE Gel.
<Protein Expression>
Day 5.
The sample in the conical tube was transferred into the centrifuge tube.
Then, it was spin down in the big centrifuge.
The 50uL of sample #2 was collected and stored in the 4degree Celsius with other samples collected before.
The supernatant was transferred into the conical tube and pH was checked. It had pH of 7.9.
Then, the syringe filter was processed with 0.45um PES.
The protein purification protocol was performed right after.
<Virtual Screen YEPTP>
The top 10 ligands with polar contacts were examined in the pymol and pasted into the lab notebook.
November 29, 2012
<Protein Expression>
Day 4.
The tube containing pellet was thaw on the ice. After that, the sonication was proceeded while surrounding the tube in ice within a glass beaker.
It was load onto platform so that sonicator tip does not touch tube.
The Output control was set at 5.5 and the four steps were processed.
Then, the spin down step was performed and sample#2 was saved.
<Virtual Screen YEPTP>
Finished 2nd GOLD run and obtained top 10% ligand.
November 27, 2012 <Virtual Screen YEPTP>
1st GOLD run submitted before Thanksgiving break and obtained top 10% ligand.
The 2nd GOLD run was submitted.
112612 - Good. Dr B
November 20, 2012
<Protein Expression> Day 3.
The fresh, pre-made LB was warmed up in the incubator.
The sample stored in the 4degree Celsius freezer was warmed to room temperature and 10mL of the sample was added into the 500mL LB in 1L flask.
The OD at 600nm was measured and recorded. Culture was keep added within 5mL increments until OD600 is around 0.1
Then, the 500uL Kan was added and stored into the incubator.
OD600 was checked every 30minutes until 0.5. However, I stopped at the 0.332 since time was running out.
500uL of Sample #0 was collected, then in the flask 250uL of 1M IPTC was added.
The flask was stored in the incubator and sample was stored in the 4degree Celsius freezer.
After 2.5hr pasesd, the flask was takend out and 500uL of sample #1 was collected after induction.
The 500mL is separated into two bottles and put into 37degree Celsius big shaking incubator in the 1st floor for 20min.
The pellet are stored in the 4 degree Celsius.
Result:
Time
OD at 600nm
0min
0.11
30min
0.138
1hr
0.128
1.5hr
0.157
2hr
0.332
<Virtual Screen YEPTP>
Resolution
1.8 Å
Clashscore, all atoms
5.3
Poor rotamers
0.21%
Ramachandran outliers
0%
Ramachandran favored
97.14%
Cβ deviations >0.25Å
0
MolProbity score^
1.44
Residues with bad bonds
0%
Residues with bad angles
0%
Error in Active Site
1chain of YEPTP which has active site
All-Atom
Contacts
Clashscore, all atoms:
5.76
91st percentile* (N=1784, all resolutions)
Clashscore is the number of serious steric overlaps (> 0.4 Å) per 1000 atoms.
Protein
Geometry
Poor rotamers
0.42%
Goal: <1%
Ramachandran outliers
0.00%
Goal: <0.2%
Ramachandran favored
96.79%
Goal: >98%
Cβ deviations >0.25Å
0
Goal: 0
MolProbity score^
1.51
95th percentile* (N=27675, 0Å - 99Å)
Residues with bad bonds:
0.00%
Goal: 0%
Residues with bad angles:
0.00%
Goal: <0.1%
November 19, 2012
<Homology Model>
Proten Tyrosine Phosphatase homology model was re-submitted.
Result:
<Protein Expression> Day 2.
LB media from the refrigerator was warmed in the incubator.
In the two 500mL flasks, 100mL of LB media were inoculated.
Two separate single colonies of FtHap cells pre-made from overnight transformation were added into the flask by using sterile pipette tip.
The antibiotic was added to final concentration of 50 ug/ml Kan. Therefore, total 100uL of Kan was added to each flask since they have 100mL volume of LB media.
Two flasks were placed into the shaking incubator at 37 degree Celsius for overnight.
~12 hours, the flasks were stored in the 4 degree Celsius until next day.
November 18, 2012
Jennifer - include some 'data' or graphs here. Dr. B 11/19/12
<Homology Model>
Proten Tyrosine Phosphatase homology model had failed.
The result is saying,
- Start BLAST for highly similar template structure identification
- No suitable templates found!
- Run HHSearch to detect remotely related template structures
- Unfortunately, we could not identify useful template structures
November 16, 2012
<Protein Expression> Day 3.
Could not proceed to the day 3 since the flask in the incubator might be dried out.
Therefore, I'll restart the process.
LB media was running out, so I made LB 2.0L of LB media following by making LB media protocol.
<Homology Model>
Proten Tyrosine Phosphatase sequence was put into the swiss-model website to create a homology model.
November 15, 2012
<Protein Expression>
Day 2.
LB media from the refrigerator was warmed in the incubator.
In the two 500mL flasks, 100mL of LB media were inoculated.
Two separate single colonies of FtHap cells pre-made from overnight transformation were added into the flask by using sterile pipette tip.
The antibiotic was added to final concentration of 50 ug/ml Kan. Therefore, total 100uL of Kan was added to each flask since they have 100mL volume of LB media.
Two flasks were placed into the shaking incubator at 37 degree Celsius for overnight.
~12 hours, the flasks were stored in the 4 degree Celsius until next day
November 9, 2012
<pNIC-Bsa4 cloning>
Part 4. Making Master Plate
There were any colonies shown on the both plates. Those two plates were thrown away into the bio-hazard bin.
Therefore, I couldn't go onto the next step.
Since cloning process has failed, I might make MtPSTP as surrogate next week.
November 7, 2012
<pNIC-Bsa4 cloning>
Part 1. Preparation of pNIC-Bsa4 as Accepting Vector Gel Check
Result:
The gel image of pNIC-Bsa4 as Accepting Vector
Lane 1: DNA 1kb ladder
Lane 2: Ivy's pNIC-Bsa4
Lane 3: My pNIC-Bsa4. It had two distinct bands which shows the pNIC-Bsa4 was cut into two fragments by ECO311.
Part 2. Cohesive End Generation on PCR Inserts and Accepting Vector
The sample solutions were made and placed in the water bath for 30min at 22 degree Celsius. And then, they were heat inactivated for 20min at 75 degree Celsius. Result:
The nanodrop graph of pNIC-Bsa4 as Accepting Vector
Part 3. Annealing and Transformation
This part was done immeditely after Cohesive Ends generation of accepting vector and PCR insert.
Tube A was the mixture of 2uL of T4-treated Accepting Vector with 4uL of each T4-treated Insert.
Tube B was my trial with the mixture of 12uL of T4-treated Accepting Vector and 6uL of T4-treated Insert.
They were stored at the room temperature for 10 minutes, and then transferred to ice.
25uL of DH5alpha Competent cells were added into the ligation mixture in the tubes, and incubated on ice for 30minutes.
Then, they were heat shocked in the water bath for exactly 30 seconds in 42 degree Celsius, placed back on the ice bucket, and added 100uL of pre-warmed SOC.
These two tubes were shaked in the 37 degree Celsius shaker for an hour.
After an hour passed, the transformation mixture of two tubes were spread to plate of LB-Agar, Kanamycin, and sucrose with colirollers.
They were then incubated upside down overnight at 37 degree Celsius for a day.
November 5, 2012
<pNIC-Bsa4 cloning> Part 1. Preparation of pNIC-Bsa4 as Accepting Vector
The sample was made of pNIC-Bsa4 plasmid, Fermentas Buffer, 100X BSA, ECO311 from Fermentas, and nanopure water.
The volume of pNIC-Bsa4 was calculated but the amount was over 25uL which is the final volume. So, all the reagents used were scaled up with 1.4.
Thus, the final volume become 35uL instead of 25uL.
This sample was placed in the water bath of 37degree Celsius for 2 to 3 hours.
After the incubation, the sample was PCR cleaned up and then nanodropped to find the final concentratoin.
Results:
The nanodrop graph results after PCR cleanup of pNIC-Bsa4
October 26, 2012
<PCR Primer Overlap>
Part 4. PCR squared reaction
There will be great lose in the PCR cleanup procedure after the PCR squared reaction, therefore the PCR squared reaction is needed to make a lot of PCR product.
I made three samples of PCR squared reaction, Yellow tube from the sample of second lane in secondary PCR, Pink tube from the sample of third lane in secondary PCR, and one tube from the Ivy's secondary PCR sample.
*The pink tube from the sample of third lane in secondary PCR was the one had distinct bands on the gel.
The total volume of 200uL of sample was made, and divided into 4 tubes and run on the PCR machine.
Part 5. PCR cleanup
The red box of PCR cleanup kit was used.
The 4 sample tubes were combined into one sample.
After each solution was added, the sample was centrifuged with maximum speed, then the eluate was decanted.
Only the eluate from the last step which is my DNA sample to clone was conserved.
Part 6. Nanodrop
The eluate was nanodropped.
First, the sterile water was used to calibrate the spectrophotometer.
Second, the elution buffer was used to blank.
Lastly, the sample was used to measure.
Results:
The nanodrop graph results after PCR squared and cleanup Result from second lane sample of secondary PCR. The graph looks like there is a contamination.
Result from third lane sample of secondary PCR. The graph looks good with high concentration.
Result from Ivy’s sample. Graph looks good but the concentration is lower than my sample.
October 19, 2012
102112- Jennifer - ok. If you can't get secondary to work, then use soem of Ivy's sample to make your PCR squared - Dr. B
<PCR Primer Overlap>
Part 3. Secondary PCR
Re-run the secondary PCR with 100bp ladder Result: Gel image of secondary PCR
Finally bands appeared on the gel.
Lane 2. 100bp ladder
Lane 3. secondary PCR sample
Lane 4. secondary PCR sample
Lane 3 or 4 should have distinct band which corresponds to the size of the YEPEP. However, it wasn't shown on the gel for lane 3. But there was bands appeared on lane 4.
Lane 6 through 10 is Stephanie's and Aldo's who shared same gel with me.
October 17, 2012 <PCR Primer Overlap>
Part 3. Primary and Secondary PCR
Re-run the primary and secondary PCR with 100bp ladder
Result: Gel image of primary and secondary PCR
1st trial. Something went wrong. Even after three hours, the samples on the gel didn't move at all.
The voltage was keep lowering to 70v. Tried different trays and lid and seemed like working for five minutes, but after that voltage lowered to 70.
So of course, couldn't see any bands on the gel image.
Guessing the gel was a problem.
Trial 2. Therefore, gel was remade and samples were loaded.
Finally, could see the smear on the lane 4 which is primary PCR.
It's hard to see but when you invert it, then you can see the smear.
However, still can't see the secondary PCR.
The gel was torn at the bottom before I capture the image.
Still don't know why the distinct bands are not showing when secondary PCR sample was run.
October 15, 2012 <PCR Primer Overlap>
Part 3. Secondary PCR
Re-run the secondary PCR with 100bp ladder Result: Gel image of secondary PCR
The result was bad. Only the DNA ladder(100bp) was shown in the lane2 from the right.
From the right side,
Lane 2. 100bp ladder
Lane 4. secondary PCR at melting temperature of 500 degree Celsius
Lane 6. secondary PCR at melting temperature of 60 degree Celsius
Lane 2 or 4 should have distinct band which corresponds to the size of the YEPEP. However, it wasn't shown on the gel. Actually, could not see any band for lane 4 and 6.
Lane 10 is Stephanie's who worked with me.
She got good primary sample result as it looks like smear.
She used the melting temperature of 58 as in the protocol, and got a result.
Therefore, I could conclude that either my oligo mix was contaminated since the well box wasn't stored well or my personal mistake that I didn't catch.
I might use Stephanie's primary sample to do secondary PCR since this is my third trial and still couldn't get the result.
October 11, 2012
101612 - Jennifer, ok crop your gem images better to get rid of the black space. -- Dr. B
<PCR Primer Overlap>
Part 2. Primary PCR
Re-run the primary PCR with 100bp ladder Result: Gel image of primary PCR
From the left.
Lane 2. 100 bp ladder
Lane 3. primary PCR at melting temperature of 50 degree Celsius
Lane 4. primary PCR at melting temperature of 60 degree Celsius
Primary PCR should look like smear.
But on my gel, there is a band-like image on the lane 3 and 4 from the left.
Not sure what it is exactly.
The result was not good.
Lane2 of 100bp ladder looks good though.
October 8, 2012 100912 - the 100bp ladder looks degraded - did you use one that had been sitting out? Or perhaps the whole gel is bad. ?? - Dr B <PCR Primer Overlap>
Part 3. Secondary PCR
Re-run the primary and secondary PCR with 100bp ladder Result: Gel image of primary and secondaryPCR
The result was bad. Only the DNA ladder(100bp) was shown in the lane1.
Lane 1. 100bp ladder
Lane 2. primary PCR sample
Lane 3: secondary PCR sample
Lane 2 was supposed to look like a smear.
Lane 3 should have distinct band which corresponds to the size of the YEPEP. However, it wasn't shown on the gel.
Therefore, I couldn't proceed to PCR squared reaction and have to re-do it.
October 8, 2012 <PCR Primer Overlap>
Part 2. Primary PCR
Re-run the primary PCR with 100bp ladder Result: Gel image of primary PCR
From the left.
Lane 2. 100 bp ladder
Lane 3. primary PCR
Primary PCR should look like smear.
But on my gel, there is a band-like image on the lane 3 from the lef.
Not sure what it is exactly.
Lane2 of 100bp ladder looks good though.
October 4, 2012 100912 - Jennifer - ok. keep trying. Crop your gels better so taht only the gel is visible and not all of the black space. - Dr. B <PCR Primer Overlap>
Part 3. Secondary PCR
YEPTP forward and reverse primer finally came.
First, forward and reverse primers were diluted to 100uM of stock solution.
Second, These 100uM of stock solution was diluted into 20uM of 100uL working dilution.
After the secondary primer solution was made, it was run into the PRC machine and then run on the gel with primary primer solution made last time.
Result: Gel image of PCR Primer Overlap
The result was bad. Only the DNA ladder(100bp) was shown in the lane1.
Lane 2: primary PCR sample
Lane 3: secondary PCR sample
Lane 2 was supposed to look like a smear.
Lane 3 should have distinct band which corresponds to the size of the YEPEP. However, it wasn't shown on the gel.
Therefore, I couldn't proceed to PCR squared reaction and have to re-do it.
There are two biggest possibility of this poor result that I can think.
First, the reagents used to make a sample was contaminated. Dr. B told me that KOD reagents might be contaminated since other students also didn't get the result.
Second, the melting temperature can be changed to get better result. Maybe lower or higher than 58degree Celsius.
Next time, I'll use new KOD reagents in the box and change the melting temperature to get better result.
September 28, 2012
093012 - Jennifer. Ok good. Show your sequences form Primer design (don't link to a Word document). -- Dr. B <PCR Primer Overlap>
Part 1. Preparing oligo mix
Primers from the well plate for Yersinia enterocolitica(YE) from A1 through B8 since my target was protein-tyrosine-phosphatase(PTP) were mixed together to make oligo mix.
Part 2. Primary PCR
First, I was planning to use Q5 polymerase. But there was only a little amount left, KOD polymerase was used instead of Q5.
After the sample was run in PCR machine, it was stored in the freezer for secondary PCR later since the reverse and forward primers of YEPTP hasn't arrived.
Also it was not run on the gel since I want to put both primary and secondary PCR samples on the same gel.
September 27, 2012
<PCR Primer Design for PNIC-Bsa4 Cloning>
Organism: Yersinia enterocolitica
Target: protein-tyrosine-phosphatase CDS(coding DNA sequence) was inserted into the pNIC-Bsa4, which is an accepting vector, where cut by the BsaI.
Result:
<Midi Prep>
<Nano drop graph of the DNA sample from transformed bacterial cells(pNI-Bsa4) after the Midi prep>
<PCR protocol> Part 2. PCR and Gel
Result:Gel pLIC sequencing vectors of pNIC-Bsa4
Only marker was shown. I'll redo it.
September 20, 2012
<PCR protocol> Part 1. pLIC sequencing vectors of pNIC-Bsa4 - Preparation of Master mix
Master mix of pNIC-Bsa4, Forward and Reverse Primers, dNT mix, and ThermoPol Buffer NEB were prepared.
In the tubes, equal portion of master mix was added and DNA template and DDW were added.
These prepared tubes were stored in the freeze for next steps.
Jennifer - ok good. You can put your figure legend below the gel image. Also, is the PCR band the right size? Does it match the expected size of the gene you are amplifying? - DR. B 091812
September 15, 2012
<PCR protocol> Part 2. PCR and Gel
In the tubes in the freeze, diluted Taq DNA polymerase NEB was added and then placed into the PCR machine.
PCR was preheated and then thermal program was run.
The program took an hour and thirty five minutes, so while waiting, the Agarose Gel was made.
Since the rubber of the tray was misplaced, the gel was leaked. So, I had to made another gel.
On the gel, samples were loaded and gel was run for about 40 min.
The gel was viewed and labeled.
Results: 1st PCR gel of pGBR 22 with M13 forward and reverse primer.
Gel image viewed with UV.
The Lane 1 is marker.
Lane 2 is Sample A with 1:1000 ratio of Template and 1ng of DNA template.
Lane 3 is Sample B with 1:1000 ratio of Template and 10ng of DNA template.
Lane 4 is Sample C with 1:100 ratio of Template and 10ng of DNA template.
Lane 5 is Sample D no DNA control.
There was no band in Lane 3 and 4.
The lane 2 and 5 had one thick band.
September 12, 2012
<PCR protocol> Part 1. Preparation of Master mix
Master mix of pGBR22, Forward and Reverse Primers, dNTP mix, and ThermoPol Buffer NEB were prepared.
In the tubes, equal portion of master mix was added and DNA template and DDW were added.
These prepared tubes were stored in the freeze for next steps.
September 11, 2012
<Transformation of competent cells for plasmid prep of pNIC-Bsa4> Day 2.
It was performed in the late afternoon.
On the control plate, there were hundreds of colonies(yellow circular) presented.
On the no control plate, there were two bigger size than the colonies on the control plate presented. These were considered as contamination. Since there should be no colonies appeared in no control plate.
After adding Kanamycin into the Erlenmeyer flask containing 160mL LB and colony, they were stored in the shaker to let colonies grow up overnight.
Jennifer, put these in reverse order -- Thanks, DR. B 091012
September 10, 2012
<Transformation of competent cells for plasmid prep of pNIC-Bsa4>
The two Agar plates were in the incubator over the weekend.
So they were moved from 37degree Celcius incubator to 4degree Celcius freeze for the Day 2 experiment tomorrow.
September 7, 2012
<Analyzing DNA sequence>
Worked on the analyzing DNA sequence in the computer lab.
<Transformation of competent cells for plasmid prep of pNIC-Bsa4> Day 1.
Two agar plates were prepared and stored in incubator.
One for no DNA control and the oher one for DNA contorl of E.Coli DH5alpha bacteria.
September 6, 2012
<Primer Dilution>
Practiced dilution of primers with ordered one.
pLIC forward was used.
Did calculation for the amount of TE and stock solution.
Final product of Stock solutions and [[#|Working]] Dilutions were stored in the [[#|freezer]].
<DNA sequencing facility for pNIC-Bsa4 vector>
This lab was performed with the [[#|working]] dilution made in the Primer Dilution experiment to determine gene present in pNIC-Bsa4.
By using m1v1=m2v2, the amount of template, primer, and water were calculated.
For the reverse, I used Shane's.
The DNA sequencing request form was submitted online and the final solution was taken over to MBB and stored in the fridge.
August 31, 2012
<PCR Primer Design for Primer Overlap Assembly PCR>
Target (protein/gene name): 1-deoxy-D-xylulose 5-phosphate reductoisomerase
Organism: Francisella tularensis subsp. tularensis SCHU S4
Today I worked on primer overlap assembly PCR with my target DXR of organism Francisella tularensis. Next week, I'm going to work onProtocolPCR_PrimerOverlap [[image:data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAeUAAAElCAIAAABVum2BAAAZDklEQVR4nO2dMZKjOteGtYhZwOxgtuANUP82tAiSP3Hf+oqa4FbdhKobUuTOiZ2SOnRIxg74gvO1igHsphsjdE4/T03gNligfkeP1QIkNwAAgAbc0ScAAACr+J+v333zMAAKTHv++4evz+fzMd8XAADwlOBnfA0AkDT4GgBAB/gaAEAH+BoAQAf4GgBAB/gaAEAH+BoAQAf4GgBAB/gaAEAH+PoFFEXhnPPed10333q5XJxz9/t9/GbTNFmWOefyPI91mgCgG3y9lbquy7IchqEsS3kxJs/z2+028XXbtnme930/DMOi4gEA5uDrrXjv27YdhqFt2yzLFveZ+DrIGgBgPfh6K8HF9/vdueVpaSe+ds6VZemcy7JMXL9IVVVhXq7Oc/e0/9BZA+VVW9vAkr4oyvN/I1X8uP1+v1UZd8ArkAAL7eSugjt23rvV/cZ+5refFE8RPIBQDw9VbCZcayLOu6Xtxn4uuyLK/X6zAMl8ulKIo1RyEXAMDXW+m6znvvnBubNwja/Ym8Of7IyvtDyAUA8LUOyAUA8LUOyAUA8LUOyAUA8LUOyAUA8LUOyAUA8LUOyAUA8LUOyAUA8LUOyAUA8LUOyAUA8LUOyAUA8LUOyAVicjqdJlMpnE6no08K8LUSyAUOYeX8kRAHfK0DcoEI/NN5N/zrn5m0ef5vcFX+uAXCAC+Dpx8LUOyAUigK8TB1/rgFwgAsHIP37+mlxv/PHzF74+HHytA3KBCMy70ov/jj7N7wu+1gG5QATwdeLg6xdQFIVzznu/uLjX5XKZrN84DEPf91mWrb9ZilwgAvg6cfD1Vuq6DuvtyosxeZ7fbre5r4uiaJoGX0NS4OvEwddb8d63bTsMQ9u2WZYt7jPx9fV6vVwu9/sdX0NS4OvEwddbCS5+4t+xr/u+994/338OuUAE8HXi4OutfNbXZVnebrfn+wtVVZ3feXt7OwPszEpfH3iGVVW9ugVr4oyvN5JlWRgPkY7znLGv3Yy+7z88CrlABOhfJw6+3kq4zFiWZV3Xi/vMrzcOjIdAeuDrxMHXW+m6znvvnCuKIrwZBD3pSo+tja8hNfB14uBrHZALRABfJw6+1gG5QATwdeLgax2QC0QAXycOvtYBuUAE8HXi4GsdkAtEAF8nDr7WAblABPB14uBrHZALRABfJw6+1gG5QATwdeLgax2QC0QAXycOvtYBuUAE8HXi4GsdkAtEAF8nDr7WAblABPB14uBrHZALRABfJw6+1gG5QATwdeLgax2QC0QAXycOvtYBuUAE8HXi4GsdkAtEAF8nDr7WAblABPB14uBrHZALRABfJw6+fgFFUTjnvPdd1823Xi6XycqNspK6fGS+Du8i5AIRwNeJg6+3Utd1WB9dXozJ8/x2u018ned53/fykSzL1hyFXCAC+Dpx8PVWvPdt2w7D0LbtI/lOfB1ommblEunkAhHA14mDr7cSXHy/3x/J95Gvi6KYd8kDVVWd33l7ezsD7MxKXx94hlVVvarlauSMrzfyZV9Lf3xxyHsOuUAE6F8nDr7eSpZlYTzEe7+4z9zXbds65+SDayAXiAC+Thx8vZVwmbEsy7quF/eZ3x/yKVkP5AJRwNeJg6+30nWd3JxXFEV4Mwja/cnim2uOQi4QAXydOPhaB+QCEcDXiYOvdUAuEAF8nTj4WgfkAhHA14mDr3VALhABfJ04+FoH5AIRwNeJg691QC4QAXydOPhaB+QCEcDXiYOvdUAuEAF8nTj4WgfkAhHA14mDr3VALhABfJ04+FoH5AIRwNeJg691QC4QAXydOPhaB+QCEcDXiYOvdUAuEAF8nTj4WgfkAhHA14mDr3VALhABfJ04+FoH5AIRwNeJg691QC4QAXydOPh6F4qicM557xeXP79cLosrpj+BXCAC+Dpx8PXrqes6rMArL8bkeX673fA1JAi+Thx8/Xq897L2edu2WZYt7oOvIUHwdeLg69cTXHy/3x8tf46vIUHwdeLg69fzKl9XVXV+5+3t7QywMyt9feAZVlX1+harhzO+fjlZloXxEO/94j70ryFB6F8nDr5+PeEyY1mWdV0v7oOvIUHwdeLg69fTdZ333jlXFEV4Mwja/clKa5MLRGBvX4cSfvz8NWkIP37+4vvgQ/C1DsgFIhDN1/Tfvwa+1gG5QATwdeLgax2QC0QAXycOvtYBuUAE8HXi4GsdkAtEAF8nDr7WAblABPB14uBrHZALRABfJw6+1gG5QATwdeLgax2QC0QAXycOvtYBuUAE8HXivMbXMhHd9Xp92XntX7Iu8DVEAF8nzld8LQ51zvV9P36naV7/i96vZF3ga4gAvk6cr/i6rmuZzyhoFF/vDb6GCODrxPmKr7Msa5omz/MwubNYtSgK8fjlcpH3ZdnZPM+HYej7vixL6ZgXRSF9c5kh2jknZYaiZEXa6/W6WPK8qPCpLMvGJyArck0mpJZPLa6Emyz4GiKArxPn075u29Y513Xd9XqVF8O7ZMW54ujb7dY0jby4Xq9N0/R93zRN0zR1XUuXues6sXn41P1+D4Mtss9iyfOixrvleS5jNfJmWZZN08hS5WLqpmmyLBtPdpo++BoigK8T59O+LstSutV93zvnZD7+8ahFeC2rgOd5Pr9aGDQaBsHDp0JPWfZcLHle1HiTFHu/38fli+LDF4z03zf83mKDryEC+DpxPu3rySzjsv73I6ve73fpAtd1PR7ECP3cR75eHBkPr+dFfejrruvkx8mZawFfQwTwdeJ8ztcyBhJuC5Efb7fbfDhC/Cj+9d6P7Swd8yBZ6WiHTy36el7yYlETX0/Klx9vt9tev8s9wdcQAXydOJ/ztVz3Cz+KLsNwxORyX9d1Ytg8z7uuC6tkee+997LCoQwly5tySXByw/WjkidFjT8l3yKyzpZ8MFxvDIdzfy7WlT74GiKArxOH5xtfgFwIlUuaa7bebrfwfSNfJB9CLhABfJ04+HordV2H1dDlxYdbsyyTYZnb7bZyGJ1cIAL4OnHw9VZCH1nu9V6z1XsvwzUyuL/mKOQCEcDXiYOvtxLGymUMfc1WGdm/Xq9lWYaLt3Oqqjq/8/b2dgbYmZU+PbD8qqp2a8oKOOPrjXzB1/f7XXwdLoR+CLnAmNPpNLmz9nQ6bS+W/nXi4OutTB52X7M1yzKROOPXsJHXPvaFrxMHX28lXEgsy1Ke9vxwa5Zl4dZDfA1bwNffisN8fb/fv/CEYeiZpkO4GXx8Q3cYBlncGqad8t6vfH4HX8Oi2pxzL5Qdvk6cw3ztvZ9MEjJ+cvIRl8tl5Q0VxsDXgK/hGF/LJH+hazmfUPsRMofUymt0lsDXgK/hGF/LbE2hN/1oQm0ZUhhP3BqegI9wkkmBr2FstB8/f03uD/nx8xe+Ns8xvpb/YfL6yYTa4uswf9P8s98HfA0RZIevE+d4Xz+ZUBtfB76Vr3e6uVg7+BqO8bVMkve/AJeEJtGeCe+1rX1NUv4Vv5OvANv5ifgK/hyPHrMAYyn1Bb+tqyVJjIPdwex/j19wFfj8HXcPD9IY8m1B7el+zy3ssKNeGBQO4PMcliu33tzQ/awddw5P3X86cBP0Tu/NvjfBIHX9OS8TXwfKMO8DUtGV8D84fowHwu4+a6083F2sHXgK91YD4XWvKH4GvA1zownwst+UPwNeBrHZjPhZb8Ifga8LUOzOdCS/4QfA34Wgfmc6Elfwi+fgnPDyprq8qTH596zmP92n6CPF/y2bvd8LUOzOeSQktOHHz9Ep4fNMsyeV6v7/s8z3c6hzzP5dE/fG0T87mk0JITB1+/hA99PX+O79EaUvLotazt9+GSUjKvxniKBXx9DEVRyB9QMhnsmq1hXpSV3+Hmc0mhJScOvn4Jzw8qYi2KYmzSsizlx/EgyaTxBvk+2nm+8h++PoC6rsOKuvOJqBa3tm2b57nMcrWo+Dnmc0mhJScOvn4JHx6073uZEzQsWDh+dCusgTWxbfhxcWeZNXoywI2vDyDEIN/Ma7YGWa/HfC4ptOTEwdcvYeVBRdny2i0tLfvE14ut+3a75Xm+2CVfD77eSvily5zda7bKHIQykffKa8rmc0mhJScOvn4Jzw8a+lJhHZVhGIqiCH3twCNfL+4syHzRj0pYA77eytd8HZamfDLpVVVV53fe3t7OplnZko8+zSOJ8Cva+xDby6+qamODfe7rtm3D1cIwVhlu8lszHvJo53H/bDI9znprn/H1RkIGkvSarUHci4pfxHwuKfS8Eof+9UtQ/V8LX28lXEgsy3J+J9Di1rIs5R6gy+UyvunnCeZzSaElJw6+Bny9lUf3Zj65GXP8JveHCLTkD8HXgK91YD4XWvKH4GvA1zown4ullnw6nSYXlE6n0/Zi8TXgax2Yz8VkS155MXkl+BrwtQ7M52KgJc/Pdr7+ZOKyw9eJg691YD4XAy0ZXx9evnnwtQ7M52KgJYeTfLJecOKyw9eJg691YD4XAy3ZgOwMVME2+FoH5nMx0JINyM5AFWyDr3VgPhcDLdmA7AxUwTb4WgfmczHQkg3IzkAVbIOvdWA+FwMt2YDsDFTBNvhaB+ZzMdCSDcjOQBVsg691YD4XAy3ZgOwMVME2+FoH5nMx0JINyM5AFWyDr3VgPhcDLdmA7AxUwTb4WgfmczHQkg3IzkAVbIOvdWA+FwMt2YDsDFTBNvhaB+ZzMdCSDcjOQBVsg691YD4XAy3ZgOwMVME2+PoFFEXhnPPeLy7GuLi17/ssy9bPZ28+FwMt2YDsDFTBNvh6K3VdhxXQ5cWarUVRNE2DrwMGWrIB2Rmogm3w9Va8923bDsPQtm2WZWu2Xq/Xy+Vyv9/xdcBASzYgOwNVsA2+3opz7n6/D8Ow6N/51r7vvfeP9h9TVdX5nbe3t7NpVrbko0/zGXtXIcKvKP0qVFW1V0vWwBlfb+Szvi7L8na7Pdr/EeZzMdDzMtA5NVAF2+DrrWRZFkY8pOP8fKub0ff9h0cxn4uBlmxAdgaqYBt8vZVwIbEsy7qu12+lfz3GQEs2IDsDVbANvt5K13Xee+dcURThzTAMsrhVwNdjDLRkA7IzUAXb4GsdmM/FQEs2IDsDVbANvtaB+VwMtGQDsjNQBdvgax2Yz8VASzYgOwNVsA2+1oH5XAy0ZAOyM1AF2+BrHZjPxUBLNiA7A1WwDb7WgflcDLRkA7IzUAXb4GsdmM/FQEs2IDsDVbANvtaB+VwMtGQDsjNQBdvgax2Yz8VASzYgOwNVsA2+1oH5XAy0ZAOyM1AF2+BrHZjPxUBLNiA7A1WwDb7WgflcDLRkA7IzUAXb4GsdmM/FQEs2IDsDVbANvtaB+VxituTT6TSZgvx0Om0v1oDsDFTBNvhaB+ZziSmjHz9/TXz94+ev9GWErwFf68B8Lsjo8PJtVME2+FoH5nNBRoeXb6MKtsHXOjCfCzI6vHwbVbANvn4BRVE457z3Xdet2Spr78qbsmzYh5jPBRkdXr6NKtgGX2+lruuwoq68+HBrnueyJnpZllmWrTmK+VyQ0eHl26iCbfD1Vrz3bdsOw9C27Vy+z7c2TbNyyV3zuSCjw8u3UQXb4OuthKXQF9c7f761KIp5l3wR87kgo8PLt1EF2+DrrXzZ19LjXhzyFqqqOr/z9vZ2Ns3KlpzyIbSXr6IKVVXt0IjVcMbXG8myLIx4eO9Xbm3b1jknm9ZgPhc6j4eXb6MKtsHXWwkXEsuyrOt6zdbPynr4Brkgo8PLt1EF2+DrrXRdJzfnFUUR3gzDII+2jllzFPO5IKPDy7dRBdvgax2YzwUZHV6+jSrYBl/rwHwuyOjw8m1UwTb4Wgfmc0FGh5dvowq2wdc6MJ8LMjq8fBtVsA2+1oH5XJDR4eXbqIJt8LUOzOeCjA4v30YVbIOvdWA+F2R0ePk2qmAbfK0D87kgo8PLt1EF2+BrHZjPBRkdXr6NKtgGX+vAfC7I6PDybVTBNvhaB+ZzQUaHl2+jCrbB1zownwsyOrx8G1WwDb7WgflckNHh5duogm3wtQ7M54KMDi/fRhVsg691YD4XZHR4+TaqYBt8rQPzuSCjw8u3UQXb4GsdmM8FGR1evo0q2AZf68B8Lsjo8PJtVME2+FoH6eRyOp0m65mdTqftxSKjw8u3UQXb4OsDKIrCOee977pu5UcSzGXlypMrQUaHl2+jCrbB17Gp6zqsmC4v1nB4LvNG5ZzT1ZK1y4hfEeDr2Hjv27YdhqFt2yzLVn5qfS7RxivwtbHybVTBNvg6Ns65+/0+DMP9fn8+pFBV1fmdt7e3M8C35++47VUlPkjK8js97XY76Qy2fHl/eOXnv5EQ6hvfwIh/jmgsLXscmyLIyHeO9Xfmp9Ll8eD9He0pDR4eVHOMQ3FxS+jk24zFiWZV3XKz9FSzu8/AiH0F5+hEN8c0Hh69h0Xee9d84VRbH+UxFy+eeffyj/2ENoLz/CISJUIWXwtQ7IBQDwtQ7IBQDwtQ7IBQDwtQ7IBQDwtQ7IBQDwtQ7IBQDwtQ7IBQDwtQ7IBQDwtQ7IBQDwtQ4+lcvlcgmzSr0cmfZE1lvY6RBlWWZZJoeQuVZeTt/3cog9Cp/M37LHIYZhaJpGqpDn+csL37sKt9st/C/aKWKT4GsdrM8lz/Pb7bafr/M87/t+eLfqHocI1HW9k++KomiaZj9f7/TLD7RtG4JYv0rRF7hcLp+aOGElWZbdbrdhGG63297/iyyBr3Xw2VwiKGM/3wXKstxDFtfr9XK5fGo+208R4ZcfZL03QayvJfxxdr/f189SCfhaBwn6uiiK9euZfRb5M/xTS1yupO97EcSuvhbyPN+p8+ucK8vSORem592D6/W6k0y7rsvz/Hq9lmUZ54vHBvhaB6n5WhYz2/Uv8WEY8jx/ef+6LEvpMO7na6Hv+7Isd/JdyPd6ve43nuC9b5pdVue63+/i612/b+yBr3WQlK/btnXORWhmewy5uBn79e92HSKXF/t968hVkD1KHoYhyzL5/8n49afA1zpIx9fRZD3sNn4t7N2/HoahKIqdzr8sy+v1Oux2PXAYhqIo1q+n8VmyLJPz3/XvA3vgax2sz2XSeXy5tSPcrCYjs7Kkw35DLvv5Os9zOf/9xvfHq17sN0S+659o4X6+Pa5nWgVf64BcAABfv4CiKJ7czDDf+oVHTsgFAPD1Vuq6Duvnzv/+Xdz6hUdOyAUA8PVWwgO1covbp7auv3+AXAAAX28lXJZZvH71fOv6R07IBQDw9aeZ3BrxZV9/+MhJVVXnd/76668zwLenqqoXt2dVnPH1RsIDWnIVceXWmHcxA4AN8PVWwoXEsiznzxcsbkXWAPAF8PVWxk8uhDfDMMijrXs/cgIA9sDXAAA6wNcAADrA1wDp0nWdc06mRnrE/X7fMmVSmCoP0gdfwysZj8vvN7XeGuq6luUNL5dLtINmWfapOZ4+3H+Nr733T+o4n3lKbi0NxV4uF1Z40QK+hlcimm6apmmaA+ddkzlb6rpumqYoiue+eyGf/Zba/q0m9xo9+VXLNDXjab7lniXnnKxFIPNcc7eSCvA1vJJgAUG6cpfLZdzVlafwBfFp6N9Jp3jyqaZpZMX3xTmz5hOKysfH91aKqsJHsiyTk1w8veH9UabJvfPjYy1+UL4khK7rwj7Sk5XlZsJfHn3fT/Z/cobX6/XRqUqZfd8/2iGcQ8hF7Bze6ft+16lf4YXga3gl4/GQ+/0uEhH7yKzQfd93Xdc0jYjmer1er9dw+2OWZXVdzz+V57lYXrQiowTSkc+ybNJFlT0nXU75iJQjonx0evJmWZZN08g3xPxYix+UjmpYQysMO4gZ+76XPztk0Xf5+2O8/5MzbJpm8YjhF/7olIb3b9C6ruVLMawPMDG4475SDeBreCXj8ZDhXSLyWjQaLm2NPSvdYfHX7Xabf0p2C8u1yJvSJ5XO4/gcJgcavykKm0hwcnrjPUWy82M9qpcbjW+EDu/ib0m+eMb7Pz/DJ0f88JTCd4MsRi5/eeBrjeBreCVuaTxkLhGZSHY8oio9a+n6rfR1YHJ3hLhpMh7yNV/LnwLzY633dfhtjMdDwm7bfS2jH89PSd7Mskz63fKXx8TXLMqlAnwNr8T9eb1xUSIyeCq7iTvEsEGyH/padnhykU1GgS+XS7jeOB7lEG2FIebJ6U32XDzWE3vmeT7fZxjpWMaLpSLz/R+d4ZNvvid1GUZelnGY4OXwvozDMH6tAnwNr2TcFS2KIlwuG4YhjFOPe6yhdymGHc9lKJ9a9LW8L11Lt3SLxbgzG0YkwkfCpOSLpzcMg1y1C9cb58d69EF57Ubj4OHWlDAzgffeey9+HO///AwfHTHcH/Joh+DlyWXY8D73hygCX0MS5HnOXcBfIwxJf41wKRLSB1/D8cif5OOBb1gPzzd+H/A1AIAO8DUAgA7wNQCADvA1AIAO8DUAgA7wNQCADvA1AIAO8DUAgA7wNQCADvA1AIAO8DUAgA7wNQCADvA1AIAO8DUAgA7wNQCADvA1AIAO8DUAgA7wNQCADqa+/v379xkAANLj9+/ff/gaAAASB18DAOjgv+1+7gUxPe0FAAAAAElFTkSuQmCC]]
ATGACGACATCTGCTCTATCTCATCCTTCCCTATTGCCACTGGATGGGGGTATTAACTTCCGTGATCTCG GTGGTAACGTCGTTGCAGATGGCCGGCGTATTAAGCGCGGGTTATTGTTTCGTTCAGGATCACTTGATCG TTTGAGCACCAAAGATTGTGCTGTTCTTAGCAGCGGCTCTGTCGCTCAAATCCTTGATTACCGCGATGCG GATGAAGTTCAGGCTAAGCCCGATATTGTGTGGCAAGGTGCCAGTTATCACAATATTCCAGCCAACCCAC CCAGCAGTGAAGTTAACGCCAATCTGGAAAAACTGACTAACGAGACGTTAGCAACATTTGATGCCAGAGC TTTCATGTTAGAGCTGTACCGTCGCCTGCCATTTAATAATCAAGCTTATAAACAGTTAGTCAGTTTGCTA CAAAATAGTGCCTCACCAGAGCATGCCGCTGCTGGCGTGGTACAGCATTGTGCAGTCGGGAAAGACCGTA CTGGAGTGGGTTCGGCTTTGGTGTTGTTTGCTTTAGGTGCTGATGAATCGACGGTATTGGAAGATTACCT GTTGACTGAAACAACACTGGCACCTTTCCGTGAACACATGCTGGCGGAATTGGCACTAAAACTAAATTCT CAGGCGCTAGGACAGTTTGCATTTGTGTTATCGGCTCGAGAAGAGTTTATTCAAACCGCACTGCGATGTA TTCAAGAGCGTTACGGGAGCAGCGAGCAATGGCTACAGCAGGAATTTGGTCTTGGCAGAATTGAGCGCGA AAAGTTGCAGTCATATTTCCTGGAGTAA
December 6, 2012
<Virtual screening>
10 best docking poses with scores screened against CBkin_UT library
December 5, 2012
<Enzyme Inhibition Assays>
Compound enzyme5154121 was used.
Absorbance at 410nm
December 4, 2012
<Enzyme Assays>
Absorbance at 410nm
Run 1
Run2
Avg
Avg-A
December 3, 2012
<Protein Characterization>
Gel image
Lane 1: marker
Lane 2: sample 0- cell lysate before induction
Lane 3: sample 1- cell lysate after induction
Lane 4: sample 2- soluble fraction
Lane 5: sample 3- flow through
Lane 6: sample 4- wash
Lane 7: sample 5- elution 1
Lane 8: sample 6- elution 2
Dried Gel image
Lane 1: marker
Lane 2: sample 0- cell lysate before induction
Lane 3: sample 1- cell lysate after induction
Lane 4: sample 2- soluble fraction
Lane 5: sample 3- flow through
Lane 6: sample 4- wash
Lane 7: sample 5- elution 1
Lane 8: sample 6- elution 2
<Measure OD of Elution #1>
The samples was concentrated and measured A280nm on Nanodrop with using storage buffer as blank.
The result:
Concentrated Elution Buffer 1
Calculation based on Googledocs.
December 1, 2012
<Protein Characterization>
After the centrifuging sample 0 and 1, only the pellets were kept and water and 6x gel loading buffer was added.
6x gel loading buffer was added to all the other samples.
The gel was placed in the mini-Protean tank and the samples were run with marker.
After 35min passed, the gel was taken out and placed into the Petri dish with nanopure water.
Gel was washed with the nanopure water for three times.
Then, the Recycled Imperial Stain was poured into the dish and placed on an orbital shaker for over an hour.
Afterwards, the gel was distained with nanopure water twice.
Tissue was folded and placed in the dish to soak up excess stain and wash the gel overnight to remove the background staning.
<Measure OD of Elution #1 and #2 samples>
The samples were measured A280nm on Nanodrop with using elution buffer as blank.
The result:
Elution Buffer 1
Elution Buffer 2
Calculation based on Googledocs.
November 30, 2012
<Protein Purification>
1mL of Ni-NTA was added into the sample tube and incubated on the ice for 45min.
The, it was transferred in to the chromatography column.
It was important that in the column, the level of buffer should keep above the top of the resin to prevent affinity matrix gets dry.
[Flow through step ] After the material in the column has settled, the sample #3 was collected.
[Wash step] to remove proteins that are only loosely bound to resin. Ni-NTA resin was wash with wash buffer and sample #4 was collected.
[Elution step] the tagged protein can be released from Ni-NTA resin by using a buffer with a high concentration of imidazole. The bound protein was eluted with Elution buffer. Eluted protein was keep on ice. The buffer was collected on the ice and sample #5 was collected. More elution buffer was added and sample #6 was collected.
All the sample collected was stored in the 4degree Celsius with other samples collected before to run on SDS-PAGE Gel.
<Protein Expression>
Day 5.
The sample in the conical tube was transferred into the centrifuge tube.
Then, it was spin down in the big centrifuge.
The 50uL of sample #2 was collected and stored in the 4degree Celsius with other samples collected before.
The supernatant was transferred into the conical tube and pH was checked. It had pH of 7.9.
Then, the syringe filter was processed with 0.45um PES.
The protein purification protocol was performed right after.
<Virtual Screen YEPTP>
The top 10 ligands with polar contacts were examined in the pymol and pasted into the lab notebook.
November 29, 2012
<Protein Expression>
Day 4.
The tube containing pellet was thaw on the ice. After that, the sonication was proceeded while surrounding the tube in ice within a glass beaker.
It was load onto platform so that sonicator tip does not touch tube.
The Output control was set at 5.5 and the four steps were processed.
Then, the spin down step was performed and sample#2 was saved.
<Virtual Screen YEPTP>
Finished 2nd GOLD run and obtained top 10% ligand.
November 27, 2012
<Virtual Screen YEPTP>
1st GOLD run submitted before Thanksgiving break and obtained top 10% ligand.
The 2nd GOLD run was submitted.
112612 - Good. Dr B
November 20, 2012
<Protein Expression>
Day 3.
The fresh, pre-made LB was warmed up in the incubator.
The sample stored in the 4degree Celsius freezer was warmed to room temperature and 10mL of the sample was added into the 500mL LB in 1L flask.
The OD at 600nm was measured and recorded. Culture was keep added within 5mL increments until OD600 is around 0.1
Then, the 500uL Kan was added and stored into the incubator.
OD600 was checked every 30minutes until 0.5. However, I stopped at the 0.332 since time was running out.
500uL of Sample #0 was collected, then in the flask 250uL of 1M IPTC was added.
The flask was stored in the incubator and sample was stored in the 4degree Celsius freezer.
After 2.5hr pasesd, the flask was takend out and 500uL of sample #1 was collected after induction.
The 500mL is separated into two bottles and put into 37degree Celsius big shaking incubator in the 1st floor for 20min.
The pellet are stored in the 4 degree Celsius.
Result:
<Virtual Screen YEPTP>
1chain of YEPTP which has active site
Contacts
Geometry
November 19, 2012
<Homology Model>
Proten Tyrosine Phosphatase homology model was re-submitted.
Result:
<Protein Expression>
Day 2.
LB media from the refrigerator was warmed in the incubator.
In the two 500mL flasks, 100mL of LB media were inoculated.
Two separate single colonies of FtHap cells pre-made from overnight transformation were added into the flask by using sterile pipette tip.
The antibiotic was added to final concentration of 50 ug/ml Kan. Therefore, total 100uL of Kan was added to each flask since they have 100mL volume of LB media.
Two flasks were placed into the shaking incubator at 37 degree Celsius for overnight.
~12 hours, the flasks were stored in the 4 degree Celsius until next day.
November 18, 2012
Jennifer - include some 'data' or graphs here. Dr. B 11/19/12
<Homology Model>
Proten Tyrosine Phosphatase homology model had failed.
The result is saying,
- Start BLAST for highly similar template structure identification
- No suitable templates found!
- Run HHSearch to detect remotely related template structures
- Unfortunately, we could not identify useful template structures
November 16, 2012
<Protein Expression>
Day 3.
Could not proceed to the day 3 since the flask in the incubator might be dried out.
Therefore, I'll restart the process.
LB media was running out, so I made LB 2.0L of LB media following by making LB media protocol.
<Homology Model>
Proten Tyrosine Phosphatase sequence was put into the swiss-model website to create a homology model.
November 15, 2012
<Protein Expression>
Day 2.
LB media from the refrigerator was warmed in the incubator.
In the two 500mL flasks, 100mL of LB media were inoculated.
Two separate single colonies of FtHap cells pre-made from overnight transformation were added into the flask by using sterile pipette tip.
The antibiotic was added to final concentration of 50 ug/ml Kan. Therefore, total 100uL of Kan was added to each flask since they have 100mL volume of LB media.
Two flasks were placed into the shaking incubator at 37 degree Celsius for overnight.
~12 hours, the flasks were stored in the 4 degree Celsius until next day
November 9, 2012
<pNIC-Bsa4 cloning>
Part 4. Making Master Plate
There were any colonies shown on the both plates. Those two plates were thrown away into the bio-hazard bin.
Therefore, I couldn't go onto the next step.
Since cloning process has failed, I might make MtPSTP as surrogate next week.
November 7, 2012
<pNIC-Bsa4 cloning>
Part 1. Preparation of pNIC-Bsa4 as Accepting Vector Gel Check
Result:
The gel image of pNIC-Bsa4 as Accepting Vector
Lane 1: DNA 1kb ladder
Lane 2: Ivy's pNIC-Bsa4
Lane 3: My pNIC-Bsa4. It had two distinct bands which shows the pNIC-Bsa4 was cut into two fragments by ECO311.
Part 2. Cohesive End Generation on PCR Inserts and Accepting Vector
The sample solutions were made and placed in the water bath for 30min at 22 degree Celsius. And then, they were heat inactivated for 20min at 75 degree Celsius.
Result:
The nanodrop graph of pNIC-Bsa4 as Accepting Vector
Part 3. Annealing and Transformation
This part was done immeditely after Cohesive Ends generation of accepting vector and PCR insert.
Tube A was the mixture of 2uL of T4-treated Accepting Vector with 4uL of each T4-treated Insert.
Tube B was my trial with the mixture of 12uL of T4-treated Accepting Vector and 6uL of T4-treated Insert.
They were stored at the room temperature for 10 minutes, and then transferred to ice.
25uL of DH5alpha Competent cells were added into the ligation mixture in the tubes, and incubated on ice for 30minutes.
Then, they were heat shocked in the water bath for exactly 30 seconds in 42 degree Celsius, placed back on the ice bucket, and added 100uL of pre-warmed SOC.
These two tubes were shaked in the 37 degree Celsius shaker for an hour.
After an hour passed, the transformation mixture of two tubes were spread to plate of LB-Agar, Kanamycin, and sucrose with colirollers.
They were then incubated upside down overnight at 37 degree Celsius for a day.
November 5, 2012
<pNIC-Bsa4 cloning>
Part 1. Preparation of pNIC-Bsa4 as Accepting Vector
The sample was made of pNIC-Bsa4 plasmid, Fermentas Buffer, 100X BSA, ECO311 from Fermentas, and nanopure water.
The volume of pNIC-Bsa4 was calculated but the amount was over 25uL which is the final volume. So, all the reagents used were scaled up with 1.4.
Thus, the final volume become 35uL instead of 25uL.
This sample was placed in the water bath of 37degree Celsius for 2 to 3 hours.
After the incubation, the sample was PCR cleaned up and then nanodropped to find the final concentratoin.
Results:
The nanodrop graph results after PCR cleanup of pNIC-Bsa4
October 26, 2012
<PCR Primer Overlap>
Part 4. PCR squared reaction
There will be great lose in the PCR cleanup procedure after the PCR squared reaction, therefore the PCR squared reaction is needed to make a lot of PCR product.
I made three samples of PCR squared reaction, Yellow tube from the sample of second lane in secondary PCR, Pink tube from the sample of third lane in secondary PCR, and one tube from the Ivy's secondary PCR sample.
*The pink tube from the sample of third lane in secondary PCR was the one had distinct bands on the gel.
The total volume of 200uL of sample was made, and divided into 4 tubes and run on the PCR machine.
Part 5. PCR cleanup
The red box of PCR cleanup kit was used.
The 4 sample tubes were combined into one sample.
After each solution was added, the sample was centrifuged with maximum speed, then the eluate was decanted.
Only the eluate from the last step which is my DNA sample to clone was conserved.
Part 6. Nanodrop
The eluate was nanodropped.
First, the sterile water was used to calibrate the spectrophotometer.
Second, the elution buffer was used to blank.
Lastly, the sample was used to measure.
Results:
The nanodrop graph results after PCR squared and cleanup
Result from second lane sample of secondary PCR. The graph looks like there is a contamination.
Result from third lane sample of secondary PCR. The graph looks good with high concentration.
Result from Ivy’s sample. Graph looks good but the concentration is lower than my sample.
October 19, 2012
102112- Jennifer - ok. If you can't get secondary to work, then use soem of Ivy's sample to make your PCR squared - Dr. B
<PCR Primer Overlap>
Part 3. Secondary PCR
Re-run the secondary PCR with 100bp ladder
Result: Gel image of secondary PCR
Finally bands appeared on the gel.
Lane 2. 100bp ladder
Lane 3. secondary PCR sample
Lane 4. secondary PCR sample
Lane 3 or 4 should have distinct band which corresponds to the size of the YEPEP. However, it wasn't shown on the gel for lane 3. But there was bands appeared on lane 4.
Lane 6 through 10 is Stephanie's and Aldo's who shared same gel with me.
<Virtual Screen Refresher>
Result:
October 17, 2012
<PCR Primer Overlap>
Part 3. Primary and Secondary PCR
Re-run the primary and secondary PCR with 100bp ladder
Result: Gel image of primary and secondary PCR
1st trial. Something went wrong. Even after three hours, the samples on the gel didn't move at all.
The voltage was keep lowering to 70v. Tried different trays and lid and seemed like working for five minutes, but after that voltage lowered to 70.
So of course, couldn't see any bands on the gel image.
Guessing the gel was a problem.
Trial 2. Therefore, gel was remade and samples were loaded.
Finally, could see the smear on the lane 4 which is primary PCR.
It's hard to see but when you invert it, then you can see the smear.
However, still can't see the secondary PCR.
The gel was torn at the bottom before I capture the image.
Still don't know why the distinct bands are not showing when secondary PCR sample was run.
October 15, 2012
<PCR Primer Overlap>
Part 3. Secondary PCR
Re-run the secondary PCR with 100bp ladder
Result: Gel image of secondary PCR
The result was bad. Only the DNA ladder(100bp) was shown in the lane2 from the right.
From the right side,
Lane 2. 100bp ladder
Lane 4. secondary PCR at melting temperature of 500 degree Celsius
Lane 6. secondary PCR at melting temperature of 60 degree Celsius
Lane 2 or 4 should have distinct band which corresponds to the size of the YEPEP. However, it wasn't shown on the gel. Actually, could not see any band for lane 4 and 6.
Lane 10 is Stephanie's who worked with me.
She got good primary sample result as it looks like smear.
She used the melting temperature of 58 as in the protocol, and got a result.
Therefore, I could conclude that either my oligo mix was contaminated since the well box wasn't stored well or my personal mistake that I didn't catch.
I might use Stephanie's primary sample to do secondary PCR since this is my third trial and still couldn't get the result.
October 11, 2012
101612 - Jennifer, ok crop your gem images better to get rid of the black space. -- Dr. B
<PCR Primer Overlap>
Part 2. Primary PCR
Re-run the primary PCR with 100bp ladder
Result: Gel image of primary PCR
From the left.
Lane 2. 100 bp ladder
Lane 3. primary PCR at melting temperature of 50 degree Celsius
Lane 4. primary PCR at melting temperature of 60 degree Celsius
Primary PCR should look like smear.
But on my gel, there is a band-like image on the lane 3 and 4 from the left.
Not sure what it is exactly.
The result was not good.
Lane2 of 100bp ladder looks good though.
October 8, 2012
100912 - the 100bp ladder looks degraded - did you use one that had been sitting out? Or perhaps the whole gel is bad. ?? - Dr B
<PCR Primer Overlap>
Part 3. Secondary PCR
Re-run the primary and secondary PCR with 100bp ladder
Result: Gel image of primary and secondaryPCR
The result was bad. Only the DNA ladder(100bp) was shown in the lane1.
Lane 1. 100bp ladder
Lane 2. primary PCR sample
Lane 3: secondary PCR sample
Lane 2 was supposed to look like a smear.
Lane 3 should have distinct band which corresponds to the size of the YEPEP. However, it wasn't shown on the gel.
Therefore, I couldn't proceed to PCR squared reaction and have to re-do it.
October 8, 2012
<PCR Primer Overlap>
Part 2. Primary PCR
Re-run the primary PCR with 100bp ladder
Result: Gel image of primary PCR
From the left.
Lane 2. 100 bp ladder
Lane 3. primary PCR
Primary PCR should look like smear.
But on my gel, there is a band-like image on the lane 3 from the lef.
Not sure what it is exactly.
Lane2 of 100bp ladder looks good though.
October 4, 2012
100912 - Jennifer - ok. keep trying. Crop your gels better so taht only the gel is visible and not all of the black space. - Dr. B
<PCR Primer Overlap>
Part 3. Secondary PCR
YEPTP forward and reverse primer finally came.
First, forward and reverse primers were diluted to 100uM of stock solution.
Second, These 100uM of stock solution was diluted into 20uM of 100uL working dilution.
After the secondary primer solution was made, it was run into the PRC machine and then run on the gel with primary primer solution made last time.
Result: Gel image of PCR Primer Overlap
The result was bad. Only the DNA ladder(100bp) was shown in the lane1.
Lane 2: primary PCR sample
Lane 3: secondary PCR sample
Lane 2 was supposed to look like a smear.
Lane 3 should have distinct band which corresponds to the size of the YEPEP. However, it wasn't shown on the gel.
Therefore, I couldn't proceed to PCR squared reaction and have to re-do it.
There are two biggest possibility of this poor result that I can think.
First, the reagents used to make a sample was contaminated. Dr. B told me that KOD reagents might be contaminated since other students also didn't get the result.
Second, the melting temperature can be changed to get better result. Maybe lower or higher than 58degree Celsius.
Next time, I'll use new KOD reagents in the box and change the melting temperature to get better result.
Ocboter 2, 2012
<Pymol Refresher>
September 28, 2012
093012 - Jennifer. Ok good. Show your sequences form Primer design (don't link to a Word document). -- Dr. B
<PCR Primer Overlap>
Part 1. Preparing oligo mix
Primers from the well plate for Yersinia enterocolitica(YE) from A1 through B8 since my target was protein-tyrosine-phosphatase(PTP) were mixed together to make oligo mix.
Part 2. Primary PCR
First, I was planning to use Q5 polymerase. But there was only a little amount left, KOD polymerase was used instead of Q5.
After the sample was run in PCR machine, it was stored in the freezer for secondary PCR later since the reverse and forward primers of YEPTP hasn't arrived.
Also it was not run on the gel since I want to put both primary and secondary PCR samples on the same gel.
September 27, 2012
<PCR Primer Design for PNIC-Bsa4 Cloning>
Organism: Yersinia enterocolitica
Target: protein-tyrosine-phosphatase CDS(coding DNA sequence) was inserted into the pNIC-Bsa4, which is an accepting vector, where cut by the BsaI.
Result:
Final Result:
TAATACGACTCACTATAGGGGAATTGTGAGCGGATAACAATTCCCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATACATATGCAC
CATCATCATCATCATTCTTCTGGTGTAGATCTGGGTACCGAGAACCTGTACTTCCAATCCATGACCACCTCTGCACTCTCTCACCCATCT
CTGCTCCCGCTGGACGGTGGTATCAACTTCCGTGATCTGGGTGGTAACGTTGTTGCGGACGGTCGTCGTATTAAACGTGGTCTGCTGT
TCCGCAGCGGTAGCCTGGACCGTCTGTCTACCAAAGACTGCGCTGTTCTCTCTAGCGGTTCTGTTGCGCAGATCCTGGACTACCGTG
ACGCGGACGAAGTTCAGGCGAAACCGGACATCGTTTGGCAGGGTGCGTCTTACCACAACATCCCGGCGAACCCGCCGTCTTCTGAAG
TTAACGCGAACCTGGAAAAACTCACCAACGAAACTCTGGCCACCTTCGACGCTCGTGCGTTCATGCTGGAACTGTACCGTCGTCTGCC
GTTCAACAACCAGGCGTACAAACAGCTGGTTTCTCTCCTGCAGAACTCTGCGTCTCCGGAACACGCGGCTGCGGGTGTTGTTCAGCA
CTGCGCGGTTGGTAAAGACCGTACCGGTGTTGGTTCTGCGCTCGTCCTGTTTGCCCTCGGTGCCGACGAATCTACCGTTCTGGAAGA
CTACCTGCTGACTGAGACCACCCTGGCGCCTTTTCGTGAGCACATGCTCGCTGAACTGGCTCTGAAACTGAACTCTCAGGCGCTGGG
TCAGTTCGCCTTCGTTCTGTCTGCGCGTGAAGAATTCATCCAAACGGCCCTGCGTTGCATCCAGGAACGCTACGGTTCTAGCGAACAG
TGGCTGCAACAGGAATTCGGTCTGGGTCGTATCGAACGTGAAAAGCTCCAATCTTATTTCCTCGAATAACAGTAAAGGTGGATACGGATC
CGAATTCGAGCTCCGTCGACAAGCTTGCGGCCGCACTCGAGCACCACCACCACCACCACTGAGATCCGGCTGCTAACAAAGCCCGAA
AGGAAGCTGAGTTGGCTGCTGCCACCGCTGAGCAATAACTAGCATAACCCCTTGGGGCCTCTAAACGGGTCTTGAGGGGTTTTTTGCT
GAAAGGAGGAACTATATCCGGATTGGCGAATGGGACGCGCCCTGTAGCGGCGCATTAAGCGCGGCGGGTGTGGTGGTTACGCGCAGC
GTGACCGCTACACTTGCCAGCGCCCTAGCGCCCGCTCCTTTCGCTTTCTTCCCTTCCTTTCTCGCCACGTTCGCCGGCTTTCCCCG
TCAAGCTCTAAATCGGGGGCTCCCTTTAGGGTTCCGATTTAGTGCTTTACGGCACCTCGACCCCAAAAAACTTGATTAGGGTGATGGTT
CACGTAGTGGGCCATCGCCCTGATAGACGGTTTTTCGCCCTTTGACGTTGGAGTCCACGTTCTTTAATAGTGGACTCTTGTTCCAAACT
GGAACAACACTCAACCCTATCTCGGTCTATTCTTTTGATTTATAAGGGATTTTGCCGATTTCGGCCTATTGGTTAAAAAATGAGCTGATTTA
ACAAAAATTTAACGCGAATTTTAACAAAATATTAACGTTTACAATTTCAGGTGGCACTTTTCGGGGAAATGTGCGCGGAACCCCTATTTGTT
TATTTTTCTAAATACATTCAAATATGTATCCGCTCATGAATTAATTCTTAGAAAAACTCATCGAGCATCAAATGAAACTGCAATTTATTCATATCA
GGATTATCAATACCATATTTTTGAAAAAGCCGTTTCTGTAATGAAGGAGAAAACTCACCGAGGCAGTTCCATAGGATGGCAAGATCCTGGTA
TCGGTCTGCGATTCCGACTCGTCCAACATCAATACAACCTATTAATTTCCCCTCGTCAAAAATAAGGTTATCAAGTGAGAAATCACCATGAG
TGACGACTGAATCCGGTGAGAATGGCAAAAGTTTATGCATTTCTTTCCAGACTTGTTCAACAGGCCAGCCATTACGCTCGTCATCAAAATC
ACTCGCATCAACCAAACCGTTATTCATTCGTGATTGCGCCTGAGCGAGACGAAATACGCGATCGCTGTTAAAAGGACAATTACAAACAGGA
ATCGAATGCAACCGGCGCAGGAACACTGCCAGCGCATCAACAATATTTTCACCTGAATCAGGATATTCTTCTAATACCTGGAATGCTGTTTT
CCCGGGGATCGCAGTGGTGAGTAACCATGCATCATCAGGAGTACGGATAAAATGCTTGATGGTCGGAAGAGGCATAAATTCCGTCAGCCA
GTTTAGTCTGACCATCTCATCTGTAACATCATTGGCAACGCTACCTTTGCCATGTTTCAGAAACAACTCTGGCGCATCGGGCTTCCCATAC
AATCGATAGATTGTCGCACCTGATTGCCCGACATTATCGCGAGCCCATTTATACCCATATAAATCAGCATCCATGTTGGAATTTAATCGCGGC
CTAGAGCAAGACGTTTCCCGTTGAATATGGCTCATAACACCCCTTGTATTACTGTTTATGTAAGCAGACAGTTTTATTGTTCATGACCAAAATC
CCTTAACGTGAGTTTTCGTTCCACTGAGCGTCAGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTG
CTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTC
AGCAGAGCGCAGATACCAAATACTGTCCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCG
CTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGG
CGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGA
GCTATGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGG
GAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCA
GGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTTCTTTCC
TGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAGTGAGCTGATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGCG
AGTCAGTGAGCGAGGAAGCGGAAGAGCGCCTGATGCGGTATTTTCTCCTTACGCATCTGTGCGGTATTTCACACCGCATATATGGTGCAC
TCTCAGTACAATCTGCTCTGATGCCGCATAGTTAAGCCAGTATACACTCCGCTATCGCTACGTGACTGGGTCATGGCTGCGCCCCGACAC
CCGCCAACACCCGCTGACGCGCCCTGACGGGCTTGTCTGCTCCCGGCATCCGCTTACAGACAAGCTGTGACCGTCTCCGGGAGCTGC
ATGTGTCAGAGGTTTTCACCGTCATCACCGAAACGCGCGAGGCAGCTGCGGTAAAGCTCATCAGCGTGGTCGTGAAGCGATTCACAGATG
TCTGCCTGTTCATCCGCGTCCAGCTCGTTGAGTTTCTCCAGAAGCGTTAATGTCTGGCTTCTGATAAAGCGGGCCATGTTAAGGGCGGTTT
TTTCCTGTTTGGTCACTGATGCCTCCGTGTAAGGGGGATTTCTGTTCATGGGGGTAATGATACCGATGAAACGAGAGAGGATGCTCACGATA
CGGGTTACTGATGATGAACATGCCCGGTTACTGGAACGTTGTGAGGGTAAACAACTGGCGGTATGGATGCGGCGGGACCAGAGAAAAATCA
CTCAGGGTCAATGCCAGCGCTTCGTTAATACAGATGTAGGTGTTCCACAGGGTAGCCAGCAGCATCCTGCGATGCAGATCCGGAACATAAT
GGTGCAGGGCGCTGACTTCCGCGTTTCCAGACTTTACGAAACACGGAAACCGAAGACCATTCATGTTGTTGCTCAGGTCGCAGACGTTTT
GCAGCAGCAGTCGCTTCACGTTCGCTCGCGTATCGGTGATTCATTCTGCTAACCAGTAAGGCAACCCCGCCAGCCTAGCCGGGTCCTCA
ACGACAGGAGCACGATCATGCGCACCCGTGGGGCCGCCATGCCGGCGATAATGGCCTGCTTCTCGCCGAAACGTTTGGTGGCGGGACC
AGTGACGAAGGCTTGAGCGAGGGCGTGCAAGATTCCGAATACCGCAAGCGACAGGCCGATCATCGTCGCGCTCCAGCGAAAGCGGTCCT
CGCCGAAAATGACCCAGAGCGCTGCCGGCACCTGTCCTACGAGTTGCATGATAAAGAAGACAGTCATAAGTGCGGCGACGATAGTCATGC
CCCGCGCCCACCGGAAGGAGCTGACTGGGTTGAAGGCTCTCAAGGGCATCGGTCGAGATCCCGGTGCCTAATGAGTGAGCTAACTTACA
TTAATTGCGTTGCGCTCACTGCCCGCTTTCCAGTCGGGAAACCTGTCGTGCCAGCTGCATTAATGAATCGGCCAACGCGCGGGGAGAGG
CGGTTTGCGTATTGGGCGCCAGGGTGGTTTTTCTTTTCACCAGTGAGACGGGCAACAGCTGATTGCCCTTCACCGCCTGGCCCTGAGAG
AGTTGCAGCAAGCGGTCCACGCTGGTTTGCCCCAGCAGGCGAAAATCCTGTTTGATGGTGGTTAACGGCGGGATATAACATGAGCTGTCT
TCGGTATCGTCGTATCCCACTACCGAGATATCCGCACCAACGCGCAGCCCGGACTCGGTAATGGCGCGCATTGCGCCCAGCGCCATCTG
ATCGTTGGCAACCAGCATCGCAGTGGGAACGATGCCCTCATTCAGCATTTGCATGGTTTGTTGAAAACCGGACATGGCACTCCAGTCGCC
TTCCCGTTCCGCTATCGGCTGAATTTGATTGCGAGTGAGATATTTATGCCAGCCAGCCAGACGCAGACGCGCCGAGACAGAACTTAATGGG
CCCGCTAACAGCGCGATTTGCTGGTGACCCAATGCGACCAGATGCTCCACGCCCAGTCGCGTACCGTCTTCATGGGAGAAAATAATACTG
TTGATGGGTGTCTGGTCAGAGACATCAAGAAATAACGCCGGAACATTAGTGCAGGCAGCTTCCACAGCAATGGCATCCTGGTCATCCAGCG
GATAGTTAATGATCAGCCCACTGACGCGTTGCGCGAGAAGATTGTGCACCGCCGCTTTACAGGCTTCGACGCCGCTTCGTTCTACCATCG
ACACCACCACGCTGGCACCCAGTTGATCGGCGCGAGATTTAATCGCCGCGACAATTTGCGACGGCGCGTGCAGGGCCAGACTGGAGGT
GGCAACGCCAATCAGCAACGACTGTTTGCCCGCCAGTTGTTGTGCCACGCGGTTGGGAATGTAATTCAGCTCCGCCATCGCCGCTTCCA
CTTTTTCCCGCGTTTTCGCAGAAACGTGGCTGGCCTGGTTCACCACGCGGGAAACGGTCTGATAAGAGACACCGGCATACTCTGCGACA
TCGTATAACGTTACTGGTTTCACATTCACCACCCTGAATTGACTCTCTTCCGGGCGCTATCATGCCATACCGCGAAAGGTTTTGCGCCATT
CGATGGTGTCCGGGATCTCGACGCTCTCCCTTATGCGACTCCTGCATTAGGAAGCAGCCCAGTAGTAGGTTGAGGCCGTTGAGCACCGC
CGCCGCAAGGAATGGTGCATGCAAGGAGATGGCGCCCAACAGTCCCCCGGCCACGGGGCCTGCCACCATACCCACGCCGAAACAAGC
GCTCATGAGCCCGAAGTGGCGAGCCCGATCTTCCCCATCGGTGATGTCGGCGATATAGGCGCCAGCAACCGCACCTGTGGCGCCGGTG
ATGCCGGCCACGATGCGTCCGGCGTAGAGGATCGAGATCTCGATCCCGCGAAAT
September 21, 2012
Looks good Jennifer - Dr. B
<Midi Prep>
<Nano drop graph of the DNA sample from transformed bacterial cells(pNI-Bsa4) after the Midi prep>
<PCR protocol>
Part 2. PCR and Gel
Result:Gel
pLIC sequencing vectors of pNIC-Bsa4
Only marker was shown. I'll redo it.
September 20, 2012
<PCR protocol>
Part 1. pLIC sequencing vectors of pNIC-Bsa4
- Preparation of Master mix
Master mix of pNIC-Bsa4, Forward and Reverse Primers, dNT mix, and ThermoPol Buffer NEB were prepared.
In the tubes, equal portion of master mix was added and DNA template and DDW were added.
These prepared tubes were stored in the freeze for next steps.
Jennifer - ok good. You can put your figure legend below the gel image. Also, is the PCR band the right size? Does it match the expected size of the gene you are amplifying? - DR. B 091812
September 15, 2012
<PCR protocol>
Part 2. PCR and Gel
In the tubes in the freeze, diluted Taq DNA polymerase NEB was added and then placed into the PCR machine.
PCR was preheated and then thermal program was run.
The program took an hour and thirty five minutes, so while waiting, the Agarose Gel was made.
Since the rubber of the tray was misplaced, the gel was leaked. So, I had to made another gel.
On the gel, samples were loaded and gel was run for about 40 min.
The gel was viewed and labeled.
Results: 1st PCR gel of pGBR 22 with M13 forward and reverse primer.
Gel image viewed with UV.
The Lane 1 is marker.
Lane 2 is Sample A with 1:1000 ratio of Template and 1ng of DNA template.
Lane 3 is Sample B with 1:1000 ratio of Template and 10ng of DNA template.
Lane 4 is Sample C with 1:100 ratio of Template and 10ng of DNA template.
Lane 5 is Sample D no DNA control.
There was no band in Lane 3 and 4.
The lane 2 and 5 had one thick band.
September 12, 2012
<PCR protocol>
Part 1. Preparation of Master mix
Master mix of pGBR22, Forward and Reverse Primers, dNTP mix, and ThermoPol Buffer NEB were prepared.
In the tubes, equal portion of master mix was added and DNA template and DDW were added.
These prepared tubes were stored in the freeze for next steps.
September 11, 2012
<Transformation of competent cells for plasmid prep of pNIC-Bsa4>
Day 2.
It was performed in the late afternoon.
On the control plate, there were hundreds of colonies(yellow circular) presented.
On the no control plate, there were two bigger size than the colonies on the control plate presented. These were considered as contamination. Since there should be no colonies appeared in no control plate.
After adding Kanamycin into the Erlenmeyer flask containing 160mL LB and colony, they were stored in the shaker to let colonies grow up overnight.
Jennifer, put these in reverse order -- Thanks, DR. B 091012
September 10, 2012
<Transformation of competent cells for plasmid prep of pNIC-Bsa4>
The two Agar plates were in the incubator over the weekend.
So they were moved from 37degree Celcius incubator to 4degree Celcius freeze for the Day 2 experiment tomorrow.
September 7, 2012
<Analyzing DNA sequence>
Worked on the analyzing DNA sequence in the computer lab.
<Transformation of competent cells for plasmid prep of pNIC-Bsa4>
Day 1.
Two agar plates were prepared and stored in incubator.
One for no DNA control and the oher one for DNA contorl of E.Coli DH5alpha bacteria.
September 6, 2012
<Primer Dilution>
Practiced dilution of primers with ordered one.
pLIC forward was used.
Did calculation for the amount of TE and stock solution.
Final product of Stock solutions and [[#|Working]] Dilutions were stored in the [[#|freezer]].
<DNA sequencing facility for pNIC-Bsa4 vector>
This lab was performed with the [[#|working]] dilution made in the Primer Dilution experiment to determine gene present in pNIC-Bsa4.
By using m1v1=m2v2, the amount of template, primer, and water were calculated.
For the reverse, I used Shane's.
The DNA sequencing request form was submitted online and the final solution was taken over to MBB and stored in the fridge.
August 31, 2012
<PCR Primer Design for Primer Overlap Assembly PCR>
Target (protein/gene name): 1-deoxy-D-xylulose 5-phosphate reductoisomerase
Organism: Francisella tularensis subsp. tularensis SCHU S4
Today I worked on primer overlap assembly PCR with my target DXR of organism Francisella tularensis.
Next week, I'm going to work on ProtocolPCR_PrimerOverlap
[[image:data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAeUAAAElCAIAAABVum2BAAAZDklEQVR4nO2dMZKjOteGtYhZwOxgtuANUP82tAiSP3Hf+oqa4FbdhKobUuTOiZ2SOnRIxg74gvO1igHsphsjdE4/T03gNligfkeP1QIkNwAAgAbc0ScAAACr+J+v333zMAAKTHv++4evz+fzMd8XAADwlOBnfA0AkDT4GgBAB/gaAEAH+BoAQAf4GgBAB/gaAEAH+BoAQAf4GgBAB/gaAEAH+PoFFEXhnPPed10333q5XJxz9/t9/GbTNFmWOefyPI91mgCgG3y9lbquy7IchqEsS3kxJs/z2+028XXbtnme930/DMOi4gEA5uDrrXjv27YdhqFt2yzLFveZ+DrIGgBgPfh6K8HF9/vdueVpaSe+ds6VZemcy7JMXL9IVVVhXq7Oc/e0/9BZA+VVW9vAkr4oyvN/I1X8uP1+v1UZd8ArkAAL7eSugjt23rvV/cZ+5refFE8RPIBQDw9VbCZcayLOu6Xtxn4uuyLK/X6zAMl8ulKIo1RyEXAMDXW+m6znvvnBubNwja/Ym8Of7IyvtDyAUA8LUOyAUA8LUOyAUA8LUOyAUA8LUOyAUA8LUOyAUA8LUOyAUA8LUOyAUA8LUOyAUA8LUOyAUA8LUOyAUA8LUOyAVicjqdJlMpnE6no08K8LUSyAUOYeX8kRAHfK0DcoEI/NN5N/zrn5m0ef5vcFX+uAXCAC+Dpx8LUOyAUigK8TB1/rgFwgAsHIP37+mlxv/PHzF74+HHytA3KBCMy70ov/jj7N7wu+1gG5QATwdeLg6xdQFIVzznu/uLjX5XKZrN84DEPf91mWrb9ZilwgAvg6cfD1Vuq6DuvtyosxeZ7fbre5r4uiaJoGX0NS4OvEwddb8d63bTsMQ9u2WZYt7jPx9fV6vVwu9/sdX0NS4OvEwddbCS5+4t+xr/u+994/338OuUAE8HXi4OutfNbXZVnebrfn+wtVVZ3feXt7OwPszEpfH3iGVVW9ugVr4oyvN5JlWRgPkY7znLGv3Yy+7z88CrlABOhfJw6+3kq4zFiWZV3Xi/vMrzcOjIdAeuDrxMHXW+m6znvvnCuKIrwZBD3pSo+tja8hNfB14uBrHZALRABfJw6+1gG5QATwdeLgax2QC0QAXycOvtYBuUAE8HXi4GsdkAtEAF8nDr7WAblABPB14uBrHZALRABfJw6+1gG5QATwdeLgax2QC0QAXycOvtYBuUAE8HXi4GsdkAtEAF8nDr7WAblABPB14uBrHZALRABfJw6+1gG5QATwdeLgax2QC0QAXycOvtYBuUAE8HXi4GsdkAtEAF8nDr7WAblABPB14uBrHZALRABfJw6+fgFFUTjnvPdd1823Xi6XycqNspK6fGS+Du8i5AIRwNeJg6+3Utd1WB9dXozJ8/x2u018ned53/fykSzL1hyFXCAC+Dpx8PVWvPdt2w7D0LbtI/lOfB1ommblEunkAhHA14mDr7cSXHy/3x/J95Gvi6KYd8kDVVWd33l7ezsD7MxKXx94hlVVvarlauSMrzfyZV9Lf3xxyHsOuUAE6F8nDr7eSpZlYTzEe7+4z9zXbds65+SDayAXiAC+Thx8vZVwmbEsy7quF/eZ3x/yKVkP5AJRwNeJg6+30nWd3JxXFEV4Mwja/cnim2uOQi4QAXydOPhaB+QCEcDXiYOvdUAuEAF8nTj4WgfkAhHA14mDr3VALhABfJ04+FoH5AIRwNeJg691QC4QAXydOPhaB+QCEcDXiYOvdUAuEAF8nTj4WgfkAhHA14mDr3VALhABfJ04+FoH5AIRwNeJg691QC4QAXydOPhaB+QCEcDXiYOvdUAuEAF8nTj4WgfkAhHA14mDr3VALhABfJ04+FoH5AIRwNeJg691QC4QAXydOPh6F4qicM557xeXP79cLosrpj+BXCAC+Dpx8PXrqes6rMArL8bkeX673fA1JAi+Thx8/Xq897L2edu2WZYt7oOvIUHwdeLg69cTXHy/3x8tf46vIUHwdeLg69fzKl9XVXV+5+3t7QywMyt9feAZVlX1+harhzO+fjlZloXxEO/94j70ryFB6F8nDr5+PeEyY1mWdV0v7oOvIUHwdeLg69fTdZ333jlXFEV4Mwja/clKa5MLRGBvX4cSfvz8NWkIP37+4vvgQ/C1DsgFIhDN1/Tfvwa+1gG5QATwdeLgax2QC0QAXycOvtYBuUAE8HXi4GsdkAtEAF8nDr7WAblABPB14uBrHZALRABfJw6+1gG5QATwdeLgax2QC0QAXycOvtYBuUAE8HXivMbXMhHd9Xp92XntX7Iu8DVEAF8nzld8LQ51zvV9P36naV7/i96vZF3ga4gAvk6cr/i6rmuZzyhoFF/vDb6GCODrxPmKr7Msa5omz/MwubNYtSgK8fjlcpH3ZdnZPM+HYej7vixL6ZgXRSF9c5kh2jknZYaiZEXa6/W6WPK8qPCpLMvGJyArck0mpJZPLa6Emyz4GiKArxPn075u29Y513Xd9XqVF8O7ZMW54ujb7dY0jby4Xq9N0/R93zRN0zR1XUuXues6sXn41P1+D4Mtss9iyfOixrvleS5jNfJmWZZN08hS5WLqpmmyLBtPdpo++BoigK8T59O+LstSutV93zvnZD7+8ahFeC2rgOd5Pr9aGDQaBsHDp0JPWfZcLHle1HiTFHu/38fli+LDF4z03zf83mKDryEC+DpxPu3rySzjsv73I6ve73fpAtd1PR7ECP3cR75eHBkPr+dFfejrruvkx8mZawFfQwTwdeJ8ztcyBhJuC5Efb7fbfDhC/Cj+9d6P7Swd8yBZ6WiHTy36el7yYlETX0/Klx9vt9tev8s9wdcQAXydOJ/ztVz3Cz+KLsNwxORyX9d1Ytg8z7uuC6tkee+997LCoQwly5tySXByw/WjkidFjT8l3yKyzpZ8MFxvDIdzfy7WlT74GiKArxOH5xtfgFwIlUuaa7bebrfwfSNfJB9CLhABfJ04+HordV2H1dDlxYdbsyyTYZnb7bZyGJ1cIAL4OnHw9VZCH1nu9V6z1XsvwzUyuL/mKOQCEcDXiYOvtxLGymUMfc1WGdm/Xq9lWYaLt3Oqqjq/8/b2dgbYmZU+PbD8qqp2a8oKOOPrjXzB1/f7XXwdLoR+CLnAmNPpNLmz9nQ6bS+W/nXi4OutTB52X7M1yzKROOPXsJHXPvaFrxMHX28lXEgsy1Ke9vxwa5Zl4dZDfA1bwNffisN8fb/fv/CEYeiZpkO4GXx8Q3cYBlncGqad8t6vfH4HX8Oi2pxzL5Qdvk6cw3ztvZ9MEjJ+cvIRl8tl5Q0VxsDXgK/hGF/LJH+hazmfUPsRMofUymt0lsDXgK/hGF/LbE2hN/1oQm0ZUhhP3BqegI9wkkmBr2FstB8/f03uD/nx8xe+Ns8xvpb/YfL6yYTa4uswf9P8s98HfA0RZIevE+d4Xz+ZUBtfB76Vr3e6uVg7+BqO8bVMkve/AJeEJtGeCe+1rX1NUv4Vv5OvANv5ifgK/hyPHrMAYyn1Bb+tqyVJjIPdwex/j19wFfj8HXcPD9IY8m1B7el+zy3ssKNeGBQO4PMcliu33tzQ/awddw5P3X86cBP0Tu/NvjfBIHX9OS8TXwfKMO8DUtGV8D84fowHwu4+a6083F2sHXgK91YD4XWvKH4GvA1zownwst+UPwNeBrHZjPhZb8Ifga8LUOzOdCS/4QfA34Wgfmc6Elfwi+fgnPDyprq8qTH596zmP92n6CPF/y2bvd8LUOzOeSQktOHHz9Ep4fNMsyeV6v7/s8z3c6hzzP5dE/fG0T87mk0JITB1+/hA99PX+O79EaUvLotazt9+GSUjKvxniKBXx9DEVRyB9QMhnsmq1hXpSV3+Hmc0mhJScOvn4Jzw8qYi2KYmzSsizlx/EgyaTxBvk+2nm+8h++PoC6rsOKuvOJqBa3tm2b57nMcrWo+Dnmc0mhJScOvn4JHx6073uZEzQsWDh+dCusgTWxbfhxcWeZNXoywI2vDyDEIN/Ma7YGWa/HfC4ptOTEwdcvYeVBRdny2i0tLfvE14ut+3a75Xm+2CVfD77eSvily5zda7bKHIQykffKa8rmc0mhJScOvn4Jzw8a+lJhHZVhGIqiCH3twCNfL+4syHzRj0pYA77eytd8HZamfDLpVVVV53fe3t7OplnZko8+zSOJ8Cva+xDby6+qamODfe7rtm3D1cIwVhlu8lszHvJo53H/bDI9znprn/H1RkIGkvSarUHci4pfxHwuKfS8Eof+9UtQ/V8LX28lXEgsy3J+J9Di1rIs5R6gy+UyvunnCeZzSaElJw6+Bny9lUf3Zj65GXP8JveHCLTkD8HXgK91YD4XWvKH4GvA1zown4ullnw6nSYXlE6n0/Zi8TXgax2Yz8VkS155MXkl+BrwtQ7M52KgJc/Pdr7+ZOKyw9eJg691YD4XAy0ZXx9evnnwtQ7M52KgJYeTfLJecOKyw9eJg691YD4XAy3ZgOwMVME2+FoH5nMx0JINyM5AFWyDr3VgPhcDLdmA7AxUwTb4WgfmczHQkg3IzkAVbIOvdWA+FwMt2YDsDFTBNvhaB+ZzMdCSDcjOQBVsg691YD4XAy3ZgOwMVME2+FoH5nMx0JINyM5AFWyDr3VgPhcDLdmA7AxUwTb4WgfmczHQkg3IzkAVbIOvdWA+FwMt2YDsDFTBNvhaB+ZzMdCSDcjOQBVsg691YD4XAy3ZgOwMVME2+PoFFEXhnPPeLy7GuLi17/ssy9bPZ28+FwMt2YDsDFTBNvh6K3VdhxXQ5cWarUVRNE2DrwMGWrIB2Rmogm3w9Va8923bDsPQtm2WZWu2Xq/Xy+Vyv9/xdcBASzYgOwNVsA2+3opz7n6/D8Ow6N/51r7vvfeP9h9TVdX5nbe3t7NpVrbko0/zGXtXIcKvKP0qVFW1V0vWwBlfb+Szvi7L8na7Pdr/EeZzMdDzMtA5NVAF2+DrrWRZFkY8pOP8fKub0ff9h0cxn4uBlmxAdgaqYBt8vZVwIbEsy7qu12+lfz3GQEs2IDsDVbANvt5K13Xee+dcURThzTAMsrhVwNdjDLRkA7IzUAXb4GsdmM/FQEs2IDsDVbANvtaB+VwMtGQDsjNQBdvgax2Yz8VASzYgOwNVsA2+1oH5XAy0ZAOyM1AF2+BrHZjPxUBLNiA7A1WwDb7WgflcDLRkA7IzUAXb4GsdmM/FQEs2IDsDVbANvtaB+VwMtGQDsjNQBdvgax2Yz8VASzYgOwNVsA2+1oH5XAy0ZAOyM1AF2+BrHZjPxUBLNiA7A1WwDb7WgflcDLRkA7IzUAXb4GsdmM/FQEs2IDsDVbANvtaB+VxituTT6TSZgvx0Om0v1oDsDFTBNvhaB+ZziSmjHz9/TXz94+ev9GWErwFf68B8Lsjo8PJtVME2+FoH5nNBRoeXb6MKtsHXOjCfCzI6vHwbVbANvn4BRVE457z3Xdet2Spr78qbsmzYh5jPBRkdXr6NKtgGX2+lruuwoq68+HBrnueyJnpZllmWrTmK+VyQ0eHl26iCbfD1Vrz3bdsOw9C27Vy+z7c2TbNyyV3zuSCjw8u3UQXb4OuthKXQF9c7f761KIp5l3wR87kgo8PLt1EF2+DrrXzZ19LjXhzyFqqqOr/z9vZ2Ns3KlpzyIbSXr6IKVVXt0IjVcMbXG8myLIx4eO9Xbm3b1jknm9ZgPhc6j4eXb6MKtsHXWwkXEsuyrOt6zdbPynr4Brkgo8PLt1EF2+DrrXRdJzfnFUUR3gzDII+2jllzFPO5IKPDy7dRBdvgax2YzwUZHV6+jSrYBl/rwHwuyOjw8m1UwTb4Wgfmc0FGh5dvowq2wdc6MJ8LMjq8fBtVsA2+1oH5XJDR4eXbqIJt8LUOzOeCjA4v30YVbIOvdWA+F2R0ePk2qmAbfK0D87kgo8PLt1EF2+BrHZjPBRkdXr6NKtgGX+vAfC7I6PDybVTBNvhaB+ZzQUaHl2+jCrbB1zownwsyOrx8G1WwDb7WgflckNHh5duogm3wtQ7M54KMDi/fRhVsg691YD4XZHR4+TaqYBt8rQPzuSCjw8u3UQXb4GsdmM8FGR1evo0q2AZf68B8Lsjo8PJtVME2+FoH6eRyOp0m65mdTqftxSKjw8u3UQXb4OsDKIrCOee977pu5UcSzGXlypMrQUaHl2+jCrbB17Gp6zqsmC4v1nB4LvNG5ZzT1ZK1y4hfEeDr2Hjv27YdhqFt2yzLVn5qfS7RxivwtbHybVTBNvg6Ns65+/0+DMP9fn8+pFBV1fmdt7e3M8C35++47VUlPkjK8js97XY76Qy2fHl/eOXnv5EQ6hvfwIh/jmgsLXscmyLIyHeO9Xfmp9Ll8eD9He0pDR4eVHOMQ3FxS+jk24zFiWZV3XKz9FSzu8/AiH0F5+hEN8c0Hh69h0Xee9d84VRbH+UxFy+eeffyj/2ENoLz/CISJUIWXwtQ7IBQDwtQ7IBQDwtQ7IBQDwtQ7IBQDwtQ7IBQDwtQ7IBQDwtQ7IBQDwtQ7IBQDwtQ7IBQDwtQ4+lcvlcgmzSr0cmfZE1lvY6RBlWWZZJoeQuVZeTt/3cog9Cp/M37LHIYZhaJpGqpDn+csL37sKt9st/C/aKWKT4GsdrM8lz/Pb7bafr/M87/t+eLfqHocI1HW9k++KomiaZj9f7/TLD7RtG4JYv0rRF7hcLp+aOGElWZbdbrdhGG63297/iyyBr3Xw2VwiKGM/3wXKstxDFtfr9XK5fGo+208R4ZcfZL03QayvJfxxdr/f189SCfhaBwn6uiiK9euZfRb5M/xTS1yupO97EcSuvhbyPN+p8+ucK8vSORem592D6/W6k0y7rsvz/Hq9lmUZ54vHBvhaB6n5WhYz2/Uv8WEY8jx/ef+6LEvpMO7na6Hv+7Isd/JdyPd6ve43nuC9b5pdVue63+/i612/b+yBr3WQlK/btnXORWhmewy5uBn79e92HSKXF/t968hVkD1KHoYhyzL5/8n49afA1zpIx9fRZD3sNn4t7N2/HoahKIqdzr8sy+v1Oux2PXAYhqIo1q+n8VmyLJPz3/XvA3vgax2sz2XSeXy5tSPcrCYjs7Kkw35DLvv5Os9zOf/9xvfHq17sN0S+659o4X6+Pa5nWgVf64BcAABfv4CiKJ7czDDf+oVHTsgFAPD1Vuq6Duvnzv/+Xdz6hUdOyAUA8PVWwgO1covbp7auv3+AXAAAX28lXJZZvH71fOv6R07IBQDw9aeZ3BrxZV9/+MhJVVXnd/76668zwLenqqoXt2dVnPH1RsIDWnIVceXWmHcxA4AN8PVWwoXEsiznzxcsbkXWAPAF8PVWxk8uhDfDMMijrXs/cgIA9sDXAAA6wNcAADrA1wDp0nWdc06mRnrE/X7fMmVSmCoP0gdfwysZj8vvN7XeGuq6luUNL5dLtINmWfapOZ4+3H+Nr733T+o4n3lKbi0NxV4uF1Z40QK+hlcimm6apmmaA+ddkzlb6rpumqYoiue+eyGf/Zba/q0m9xo9+VXLNDXjab7lniXnnKxFIPNcc7eSCvA1vJJgAUG6cpfLZdzVlafwBfFp6N9Jp3jyqaZpZMX3xTmz5hOKysfH91aKqsJHsiyTk1w8veH9UabJvfPjYy1+UL4khK7rwj7Sk5XlZsJfHn3fT/Z/cobX6/XRqUqZfd8/2iGcQ8hF7Bze6ft+16lf4YXga3gl4/GQ+/0uEhH7yKzQfd93Xdc0jYjmer1er9dw+2OWZXVdzz+V57lYXrQiowTSkc+ybNJFlT0nXU75iJQjonx0evJmWZZN08g3xPxYix+UjmpYQysMO4gZ+76XPztk0Xf5+2O8/5MzbJpm8YjhF/7olIb3b9C6ruVLMawPMDG4475SDeBreCXj8ZDhXSLyWjQaLm2NPSvdYfHX7Xabf0p2C8u1yJvSJ5XO4/gcJgcavykKm0hwcnrjPUWy82M9qpcbjW+EDu/ib0m+eMb7Pz/DJ0f88JTCd4MsRi5/eeBrjeBreCVuaTxkLhGZSHY8oio9a+n6rfR1YHJ3hLhpMh7yNV/LnwLzY633dfhtjMdDwm7bfS2jH89PSd7Mskz63fKXx8TXLMqlAnwNr8T9eb1xUSIyeCq7iTvEsEGyH/padnhykU1GgS+XS7jeOB7lEG2FIebJ6U32XDzWE3vmeT7fZxjpWMaLpSLz/R+d4ZNvvid1GUZelnGY4OXwvozDMH6tAnwNr2TcFS2KIlwuG4YhjFOPe6yhdymGHc9lKJ9a9LW8L11Lt3SLxbgzG0YkwkfCpOSLpzcMg1y1C9cb58d69EF57Ubj4OHWlDAzgffeey9+HO///AwfHTHcH/Joh+DlyWXY8D73hygCX0MS5HnOXcBfIwxJf41wKRLSB1/D8cif5OOBb1gPzzd+H/A1AIAO8DUAgA7wNQCADvA1AIAO8DUAgA7wNQCADvA1AIAO8DUAgA7wNQCADvA1AIAO8DUAgA7wNQCADvA1AIAO8DUAgA7wNQCADvA1AIAO8DUAgA7wNQCADqa+/v379xkAANLj9+/ff/gaAAASB18DAOjgv+1+7gUxPe0FAAAAAElFTkSuQmCC]]